Skip to main content

Advertisement

Table 2 Primers used for qPCR

From: Validity of multiplex biomarker model of 6 genes for the differential diagnosis of thyroid nodules

Name of the gene Sequence (5'- > 3') Size of PCR product (bp) GenBank accession no.
Candidate genes
LGALS3 F CTGATTGTGCCTTATAACCTGC 100 NM_002306.3
LGALS3 R AAGCAATTCTGTTTGCATTGG   
TFF3 F GTACGTGGGCCTGTCTGC 121 NM_003226.3
TFF3 R GATCCTGGAGTCAAAGCAGC   
DPP4 F TGATGCTACAGCTGACAGTCG 164 NM_001935.3
DPP4 R CTGAGCTGTTTCCATATTCAGC   
CITED1 F GCTCTGAAATGCCAACAACG 174 NM_001144886.1
CITED1 R TGGTTCCATTTGAGGCTACC   
MET F TCTGCCTGCAATCTACAAGG 153 NM_001127500.1
MET R AAGGTGCAGCTCTCATTTCC   
CDH1 F AGAAACAGGATGGCTGAAGG 199 NM_004360.3
CDH1 R AGCACCTTCCATGACAGACC   
CCND1 F TGGTGAACAAGCTCAAGTGG 280 NM_053056.2
CCND1 R ATCACTCTGGAGAGGAAGCG   
BIRC5 F CAGCCCTTTCTCAAGGACC 152 NM_001168.2
BIRC5 R AAGCAGAAGAAACACTGGGC   
Hausekeeping genes
PGK1 F CTTAAGGTGCTCAACAACATGG 119 NM_000291.3
PGK1 R ACAGGCAAGGTAATCTTCACAC   
POLR2A F GGGTCATCTTCCCAACTGGAG 164 NM_000937.4
POLR2A R CACCAGCTTCTTGCTCAATTCC   
  1. F - forward primer, R- reverse primer