Skip to main content

Table 3 Primers sequences applied for quantitative Real-Time PCR

From: Expression of somatostatin receptor subtypes in human thyroid tumors: the immunohistochemical and molecular biology (RT-PCR) investigation

Name Sequence Size of PCR product, bp GenBank accession no.
SSTR 2A (forward)
SSTR 2A (reverse)
5'ATGCCAAGATGAAGACCATCAC 3'
5'TGAACTGATTGATGCCATCCA 3'
171 [19] NM 001050
SSTR 3 (forward)
SSTR 3 (reverse)
5'CTGGGTAACTCGCTTGGTCATCTA 3'
5'AGCGCCAGGTTGAGGATGTA 3'
86 [19] NM 001051
SSTR 1 (forward)
SSTR 1 (reverse)
5'TATCTGCCTGTGCTACGTGC 3'
5'GATGACCGACAGCTGACTCA 3'
217 [20] NM 001049
SSTR 4 (forward)
SSTR 4 (reverse)
5'ATCTTCGCAGACACCAGACC 3'
5'ATCAAGGCTGGTCACGACGA 3'
321 [19] NM 001052
SSTR 5 (forward)
SSTR 5 (reverse)
5'GTGACAACAGGACGCTGGT 3'
5'TGGTGACGGTCTTCATCTTG 3'
156 [20] NM 001053
HPRT (forward)
HPRT (reverse)
5'TGCTTTCCTTGGTCAGGCAGTAT 3'
5'TCAAATCCAACAAAGTCTGGCTTATATC3'
109 [19] NM 000194