Skip to main content

Advertisement

Table 1 Methylation-specific PCR (MSP) primers used in the present study

From: Aberrant DNA methylation of drug metabolism and transport genes in nodular goiter

Genes Allele Forward (5'→3') Reverse (5'→3') Length (bp) Annealing temperature (°C)
ABCB1 M CGAGGAATTAGTATTTAGTTAATTCGGGTCGG ACTCAACCCACGCCCCGACG 95 60
  U TGAGGAATTAGTATTTAGTTAATTTGGGTTGG ACTCAACCCACACCCCAACA 95 57
ABCB4 M GGTAAGAGCGGTAGGTTGC GAAAAACGCCTACCGTTACA 121 59
  U GGTAAGAGTGGTAGGTTGT AAAAAACACCTACCATTACA 121 55
ABCG2 M ATTTGTGCGTTAGCGTTTTC CTCCGAAATCGAACGAAATA 149 59
  U GTAATTTGTGTGTTAGTGTTTTT CCTCCAAAATCAAACAAAATAAA 149 57
CYP1A1 M TCGGCGTACGTAAGTTAGTC AAACACAAAAATCCGACGA 113 59
  U GTTGGTGTATGTAAGTTAGTT AAAACACAAAAATCCAACAA 113 56
CYP1B1 M CGCGTTTTTAAGTCGAGC ACCCACGTTTCCATTATACG 125 58
  U GGGTGTGTTTTTAAGTTGAGT ACCCACATTTCCATTATACAATA 125 56
CYP24A1 M ATGTTTTGAGGTTGTCGC AAAATCGAAACTTAACGATTCT 140 57
  U TTAATGTTTTGAGGTTGTTGT AAAATCAAAACTTAACAATTCTAAA 140 55
CYP27B1 M TTAGAGTGTTTTATCGCGTTC CTCGTATAACCTCGACAACC 164 58
  U TTTTTAGAGTGTTTTATTGTGTTT AACTCATATAACCTCAACAACCC 164 55
CYP39A1 M TAATGTAGTTCGTCGGGTTTC AACCAACGCGAAAAAAATAC 152 59
  U GGGTAATGTAGTTTGTTGGGTTTT CAACCAACACAAAAAAAATACAA 152 57
SLC1A2 M AGTTGAAGCGGGTGTTTC GAAATAAAACGCAAACGACC 110 58
  U AGTTGAAGTGGGTGTTTT AAAATAAAACACAAACAACC 110 57
SLC19A3 M GTTTGGACGTTCGGATTC CGCGACTATCGAATAAATCC 114 57
  U AAGGTTTGGATGTTTGGATTT ACCCACAACTATCAAATAAATCC 114 55
SLC26A2 M GAGGTGGTCGATCGTAAAC CGTAACGTTAACTCCTCCG 139 59
  U AAAGAGGTGGTTGATTGTAAAT TCCATAACATTAACTCCTCCAC 139 57
  1. M, mehthylation-specific primers; U, unmenthylation-specific primers